Journal: bioRxiv
Article Title: X-Chromosome Target Specificity Diverged Between Dosage Compensation Mechanisms of Two Closely Related Caenorhabditis Species
doi: 10.1101/2022.12.05.519163
Figure Lengend Snippet: DNA sequence changes mediated by genome editing. (A) DNA sequences of mutant Cbr sdc-2 alleles that were created by genome editing using zinc-finger nucleases, as described in Wood et al . 2011 . Mutations include short insertions (green) and deletions (red colons) that generate in-frame deletions and frame-shift mutations. Inserted sequences (green) frequently share homology (underlined in green) with sequences flanking the break site, as is typical of NHEJ-mediated repair. The deletions in both sdc-2(y467) and sdc-2(y469) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins and causing complete loss of gene function. For y467 , the wild-type sequence ends at codon 926-Asp. The deletion and insertion cause 18 incorrect amino acids to be translated, and a stop codon occurs in place of codon 945. For y469 , the wild-type sequence ends at codon 921-Thr. The deletion causes 26 incorrect amino acids to be translated, and a stop codon occurs in place of codon 948. (B) DNA sequence of mutant Cbr dpy-27(y705) allele created by genome editing using CRISPR/Cas9. The Cas9 target sequence was 5’ CGCTCTGGAGTACGGTAAAA 3’. The PAM is the CGC (red) immediately 3’ of the target sequence. The double strand break (DSB) site is indicated by a blue line. The mutation is a 52 bp deletion (red colons) in exon 4 that creates a premature translation stop codon and prevents formation of the full-length DPY-27 protein. The deletion starts at codon 689, and the in-frame stop codon is 2 codons past the 3’ end of the deletion. (C, D) DNA sequences of mutant Cbr sdc-2 alleles that were obtained as suppressors of the XO-specific lethality caused by a xol-1 mutation. Alleles sdc-2(y453) , sdc-2(y454) , sdc-2(y455) , and sdc-2(y460) , were created by genome editing using zinc-finger nucleases, as described in Wood et al . 2011 . The mutations in both sdc-2(y453) and sdc-2(y454) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins and causing complete loss of gene function. For sdc-2(y453) , the wild-type sequence ends at codon 563-Val. The deletion and insertion cause 6 incorrect amino acids to be translated, and a stop codon occurs in place of codon 570 (554). For sdc-2(y454) , the wild-type sequence ends at codon 563-Val. The deletion and insertion cause 11 incorrect amino acids to be translated, and a stop codon occurs in place of codon 575. The mutations in both sdc-2(y455) and sdc-2(y460) create premature translation stop codons, thereby preventing formation of full-length SDC-2 proteins. For sdc-2(y455) , the wild-type sequence ends at codon 927-His. The deletion causes 27 incorrect amino acids to be translated, and a stop codon occurs in place of codon 955. For sdc-2(y460) , the wild-type sequence ends at codon 925-Ile. The deletion and insertion cause 34 incorrect amino acids to be translated, and a stop codon occurs in place of codon 960.
Article Snippet: The Cas9 RNP mix was incubated at 37 °C for 15 min, and 1 μl of the resulting Cas9 RNP mix was combined with 0.5 μl 10 μM dpy-10 repair oligo (IDT), 0.5 μl 10 μM rex repair oligo (IDT), and 8 μl nuclease-free water.
Techniques: Sequencing, Mutagenesis, Zinc-Fingers, CRISPR